Odtnhj

I have a fasta file like this:

>gi|373248686|emb|HE586118.1| Streptomyces albus subsp. albus salinomycin biosynthesis cluster, strain DSM 41398
GGATGCGAAGGACGCGCTGCGCAAGGCGCTGTCGATGGGTGCGGACAAGGGCATCCACGT
CGAGGACGACGATCTGCACGGCACCGACGCCGTGGGTACCTCGCTGGTGCTGGCCAAGGC
>gi|1139489917|gb|KX622588.1| Hyalangium minutum strain DSM 14724 myxochromide D subtype 1 biosynthetic gene cluster and tRNA-Thr gene, complete sequence
ATGCGCAAGCTCGTCATCACGGTGGGGATTCTGGTGGGGTTGGGGCTCGTGGTCCTTTGG
TTCTGGAGCCCGGGAGGCCCAGTCCCCTCCACGGACACGGAGGGGGAAGGGCGGAGTCAG
CGCCGGCAGGCCATGGCCCGGCCCGGCTCCGCGCAGCTGGAGAGTCCCGAGGACATGGGG
>gi|930076459|gb|KR364704.1| Streptomyces sioyaensis strain BCCO10_981 putative annimycin-type biosynthetic gene cluster, partial sequence
GCCGGCAGGTGGGCCGCGGTCAGCTTCAGGACCGTGGCCGTCGCGCCCGCCAGCACCACG
GAGGCCCCCACGGCCAGCGCCGGGCCCGTGCCCGTGCCGTACGCGAGGTCCGTGCTGAAC

and I have a text file containing a list of numbers:

373248686
930076459
296280703
......

I want to do the following:

if the header in the fasta file contains the numbers in the text file:
 write all the matches(header+sequence) to a new output.fasta file.

How to do this in python? It seems easy, just some for loops may do the job, but somehow I cannot make that happen, and if my files are really big, loop in another loop may take a long time. Here's what I have tried:

from Bio import SeqIO 
import sys 

wanted = 
for line in open(sys.argv[2]):
 titles = line.strip() 
 wanted.append(titles)


seqiter = SeqIO.parse(open(sys.argv[1]), 'fasta') 
sys.stdout = open('output.fasta', 'w') 

new_seq = 

for seq in seqiter:
 new_seq.append(seq if i in seq.id for i in wanted)


SeqIO.write(new_seq, sys.stdout, "fasta")
sys.stdout.close() 

Got this error:

new_seq.append(seq if i in seq.id for i in wanted)
 ^
SyntaxError: invalid syntax

Is there a better way to do this?

Thank you!

Use a program like this

from Bio import SeqIO
import sys

# read in the text file
numbersInTxtFile = set()
# hint: use with, then you don't need to
# program file closing. Furhtermore error
# handling is comming along with this too
with open(sys.argv[2], "r") as inF:
 for line in inF:
 line = line.strip()
 if line == "": continue
 numbersInTxtFile.add(int(line))

# read in the fasta file
with open(sys.argv[1], "r") as inF:
 for record in SeqIO.parse(inF, "fasta"):
 # now check if this record in the fasta file 
 # has an id we are searching for
 name = record.description
 id = int(name.split("|")[1])
 print(id, numbersInTxtFile, id in numbersInTxtFile)
 if id in numbersInTxtFile: 
 # we need to output
 print(">%s" % name)
 print(record.seq)

which you can then call like so from the commandline

python3 nameOfProg.py inputFastaFile.fa idsToSearch.txt > outputFastaFile.fa

Import your "keeper" IDs into a dictionary rather than a list, this will be much faster as the list doesn't have to be searched thousands of times.

keepers = 
with open("ids.txt", "r") as id_handle:
 for curr_id in id_handle:
 keepers[curr_id] = True

A list comprehension generates a list, so you don't need to append to another list.

keeper_seqs = [x for x in seqiter if x.id in keepers]

With larger files you will want to loop over seqiter and write the entries one at a time to avoid memory issues.

You should also never assign to sys.stdout without a good reason, if you want to output to STDOUT just use print or sys.stdout.write().